|
ATCC
caption a7 genomic islands Caption A7 Genomic Islands, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 genomic islands/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 genomic islands - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Vector Laboratories
caption a7 lectin ligand motifs aav binding n acetylglucosamine sialic acid ![]() Caption A7 Lectin Ligand Motifs Aav Binding N Acetylglucosamine Sialic Acid, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 lectin ligand motifs aav binding n acetylglucosamine sialic acid/product/Vector Laboratories Average 93 stars, based on 1 article reviews
caption a7 lectin ligand motifs aav binding n acetylglucosamine sialic acid - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
caption a7 αl gfp β 2 wga tritc αl gfp β 2 rab11 wt ![]() Caption A7 αl Gfp β 2 Wga Tritc αl Gfp β 2 Rab11 Wt, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 αl gfp β 2 wga tritc αl gfp β 2 rab11 wt/product/Bio-Rad Average 94 stars, based on 1 article reviews
caption a7 αl gfp β 2 wga tritc αl gfp β 2 rab11 wt - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 a fumigatus a nidulans a oryzae a niger a flavus strain af293 fgsc a4 atcc 42149 cbs 513 88 nrl 3357 genome size mb ![]() Caption A7 A Fumigatus A Nidulans A Oryzae A Niger A Flavus Strain Af293 Fgsc A4 Atcc 42149 Cbs 513 88 Nrl 3357 Genome Size Mb, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 a fumigatus a nidulans a oryzae a niger a flavus strain af293 fgsc a4 atcc 42149 cbs 513 88 nrl 3357 genome size mb/product/ATCC Average 94 stars, based on 1 article reviews
caption a7 a fumigatus a nidulans a oryzae a niger a flavus strain af293 fgsc a4 atcc 42149 cbs 513 88 nrl 3357 genome size mb - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 frequency genome bc1 bc2 bc3 ba1 ba2 bt bc rep ![]() Caption A7 Frequency Genome Bc1 Bc2 Bc3 Ba1 Ba2 Bt Bc Rep, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 frequency genome bc1 bc2 bc3 ba1 ba2 bt bc rep/product/ATCC Average 95 stars, based on 1 article reviews
caption a7 frequency genome bc1 bc2 bc3 ba1 ba2 bt bc rep - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
mouse genome informatics ![]() Mouse Genome Informatics, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse genome informatics/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
mouse genome informatics - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism l lactis subsp lactis atcc 11454 dna source genomic dna forward primer † 5 cgatac catatg caaacaagtcataaaaaggtgagg ![]() Caption A7 Source Organism L Lactis Subsp Lactis Atcc 11454 Dna Source Genomic Dna Forward Primer † 5 Cgatac Catatg Caaacaagtcataaaaaggtgagg, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism l lactis subsp lactis atcc 11454 dna source genomic dna forward primer † 5 cgatac catatg caaacaagtcataaaaaggtgagg/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 source organism l lactis subsp lactis atcc 11454 dna source genomic dna forward primer † 5 cgatac catatg caaacaagtcataaaaaggtgagg - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
human genome u133 plus 2.0 array ![]() Human Genome U133 Plus 2.0 Array, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human genome u133 plus 2.0 array/product/Thermo Fisher Average 90 stars, based on 1 article reviews
human genome u133 plus 2.0 array - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain atcc lineage ![]() Caption A7 Strain Atcc Lineage, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 strain atcc lineage/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 strain atcc lineage - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
BioNano Genomics
bionano scaffolds ![]() Bionano Scaffolds, supplied by BioNano Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bionano scaffolds/product/BioNano Genomics Average 90 stars, based on 1 article reviews
bionano scaffolds - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Phase Genomics
sequence contigs ![]() Sequence Contigs, supplied by Phase Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence contigs/product/Phase Genomics Average 90 stars, based on 1 article reviews
sequence contigs - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Illumina Inc
next generation sanger 454 ![]() Next Generation Sanger 454, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/next generation sanger 454/product/Illumina Inc Average 90 stars, based on 1 article reviews
next generation sanger 454 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Human Gene Therapy Methods
Article Title: Adeno-Associated Virus 5 Transduces Adipose-Derived Stem Cells with Greater Efficacy Than Other Adeno-Associated Viral Serotypes
doi: 10.1089/hgtb.2016.123
Figure Lengend Snippet: Lectins used to determine the glycoconjugate profile of adipose-derived stem cells and the corresponding rAAV serotypes that bind to the glycosylation motif
Article Snippet: The cells were mounted with Vectashield mounting medium with DAPI (
Techniques: Binding Assay
Journal:
Article Title: Dynamic Partitioning into Lipid Rafts Controls the Endo-Exocytic Cycle of the ?L/? 2 Integrin, LFA-1, during Leukocyte Chemotaxis
doi: 10.1091/mbc.E05-05-0413
Figure Lengend Snippet: Ratiometric analysis of αL/β 2 enrichment in ruffles
Article Snippet: Cells were then inspected with a laser scanning confocal microscope MRC-1024 (
Techniques:
Journal:
Article Title: Dynamic Partitioning into Lipid Rafts Controls the Endo-Exocytic Cycle of the ?L/? 2 Integrin, LFA-1, during Leukocyte Chemotaxis
doi: 10.1091/mbc.E05-05-0413
Figure Lengend Snippet: Confocal microscopy analysis of fMLF-induced endosomal localization of αL/β2 in PMN. Primary PMN were labeled at 4°C with a Fab′ fragment of an anti-αL mAb, followed by fMLF stimulation and incubation for the indicated time points. Cells were then fixed, permeabilized, and stained with a Cy3-conjugated goat anti-mouse immunoglobulin antiserum (left). Endogenous Rab11 was detected with an affinity-purified rabbit antiserum followed by an FITC-conjugated goat anti-rabbit antibody (top and middle center panels). Endogenous LAMP-1 was detected with an anti-LAMP-1 mAb (IgG2b) followed by a FITC-conjugated, isotype-specific antiserum (bottom center). Nuclei were detected with Hoechst 33342 (blue fluorescence). Right, merged images.
Article Snippet: Cells were then inspected with a laser scanning confocal microscope MRC-1024 (
Techniques: Confocal Microscopy, Labeling, Incubation, Staining, Affinity Purification, Fluorescence
Journal:
Article Title: Dynamic Partitioning into Lipid Rafts Controls the Endo-Exocytic Cycle of the ?L/? 2 Integrin, LFA-1, during Leukocyte Chemotaxis
doi: 10.1091/mbc.E05-05-0413
Figure Lengend Snippet: αL/β2 is recycled via a Rab11-positive compartment. CHO cells stably expressing the fMLF receptor were transiently transfected with αL/β2-GFP and either a wt or a Rab11S25N mutant, expressed as monomeric DsRed chimeric constructs. Twenty-four hours posttransfection, cells were fixed and inspected by laser scanning confocal microscopy.
Article Snippet: Cells were then inspected with a laser scanning confocal microscope MRC-1024 (
Techniques: Stable Transfection, Expressing, Transfection, Mutagenesis, Construct, Confocal Microscopy
Journal:
Article Title: Fingerprinting of Bacillus thuringiensis Type Strains and Isolates by Using Bacillus cereus Group-Specific Repetitive Extragenic Palindromic Sequence-Based PCR Analysis
doi: 10.1128/AEM.71.3.1346-1355.2005
Figure Lengend Snippet: Frequency of the Bc-REP and designed primer sequences in five reported genomes of the B. cereus group a
Article Snippet: No further significant matches were found in all the genomes and nucleotide sequences available at the EMBL and NCBI gene banks, including the poorly sequenced B. mycoides (see below). table ft1 table-wrap mode="anchored" t5 TABLE 3.
Techniques:
Journal: Applied nursing research : ANR
Article Title: Animal Models in Genomic Research: Techniques, Applications, and Roles for Nurses
doi: 10.1016/j.apnr.2016.07.016
Figure Lengend Snippet: Resources
Article Snippet: Resources for appropriate selection of a model, strain, and substrain are described later ( ). table ft1 table-wrap mode="anchored"
Techniques: Sequencing, Variant Assay, Knock-Out, Functional Assay, Produced, Generated, Mutagenesis
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Full-length nisin immunity protein NisI from Lactococcus lactis in a lipid-free form: crystallization and X-ray analysis
doi: 10.1107/S2053230X17008214
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: To quench the methylation reaction, 1 M Tris–HCl pH 8.0 was added to give a concentration of 100 m M . Finally, the sample was further purified using a Superdex 200 pg 26/600 column (GE Healthcare) equilibrated with 10 m M Tris–HCl pH 8.0, 50 m M NaCl, 2 m M β-mercaptoethanol. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Cloning, Plasmid Preparation, Modification, Expressing, Sequencing, Construct, Produced
Journal: Turkish Journal of Biology
Article Title: hsa-miR-301a- and SOX10-dependent miRNA-TF-mRNA regulatory circuits in breast cancer
doi: 10.3906/biy-1708-17
Figure Lengend Snippet: The characteristics of the datasets.
Article Snippet: As a result, 2 independent mRNA studies and 1 miRNA study including breast tumors and normal samples were selected to be analyzed (Table ). table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Microarray
Journal: G3: Genes|Genomes|Genetics
Article Title: A long reads-based de-novo assembly of the genome of the Arlee homozygous line reveals chromosomal rearrangements in rainbow trout
doi: 10.1093/g3journal/jkab052
Figure Lengend Snippet: Statistical data summary of the USDA_OmykA_1.1 (Arlee) rainbow trout genome assembly
Article Snippet: The total length of the 710 unplaced scaffolds that are not anchored to a chromosome is ∼108 Mb. table ft1 table-wrap mode="anchored"
Techniques:
Journal: The Plant Cell
Article Title: Is It Ordered Correctly? Validating Genome Assemblies by Optical Mapping
doi: 10.1105/tpc.17.00514
Figure Lengend Snippet: Recent Results of Physical Maps Aligned to Their Respective Reference Genomes
Article Snippet: Some genomic regions are easily corrected, others require multiple iterations to untangle and resolve discrepancies , and others will likely remain unresolved and may require local reassembly of the underlying DNA sequence. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 3.
Techniques: Sequencing
Journal: The Plant Cell
Article Title: Is It Ordered Correctly? Validating Genome Assemblies by Optical Mapping
doi: 10.1105/tpc.17.00514
Figure Lengend Snippet: An Illustration of Bionano Contigs Likely Spanning Centromeric Regions in the G. herbaceum Reference.
Article Snippet: Some genomic regions are easily corrected, others require multiple iterations to untangle and resolve discrepancies , and others will likely remain unresolved and may require local reassembly of the underlying DNA sequence. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 3.
Techniques:
Journal: The Plant Cell
Article Title: Is It Ordered Correctly? Validating Genome Assemblies by Optical Mapping
doi: 10.1105/tpc.17.00514
Figure Lengend Snippet: Sequence Contigs from G. herbaceum Chromosome 4 Ordered and Oriented into Pseudomolecules by the Hi-C Methodology (as Assembled by PhaseGenomics).
Article Snippet: Some genomic regions are easily corrected, others require multiple iterations to untangle and resolve discrepancies , and others will likely remain unresolved and may require local reassembly of the underlying DNA sequence. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 3.
Techniques: Sequencing, Hi-C
Journal: Heredity
Article Title: From next-generation resequencing reads to a high-quality variant data set
doi: 10.1038/hdy.2016.102
Figure Lengend Snippet: Characteristics of several commercially available NGS platforms
Article Snippet: Thereby, the large amount of data with shorter read lengths, higher per-base error rates and nonuniform coverage, together with platform-specific read error profiles and artifacts , imposes several statistical and computational challenges in the reliable detection of variants from NGS data ( Harismendy et al. , 2009 ). table ft1 table-wrap mode="anchored"
Techniques: Plasmid Preparation, Sequencing